12. Malonate is a competitive inhibitor of succinate dehydrogenase, a key enzyme in the Krebs tricarboxylic acid cycle. The presence of malonate will affect the kinetic parameters of succinate dehydrogenase in which one of the following ways?

25. A person with Type 1 diabetes ran out of her prescription insulin and has not been able to inject insulin for the past 3 days. An overproduction of which of the following could cause a metabolic acidosis?

35. A 23-year-old male presents to the ER with a fracture of his humerus, sustained in what appeared to be a minor fall. He has a history of multiple fractures after a seemingly minor trauma. His underlying problem is most likely due to a mutation in which one of the following proteins?

4. A patient is on a very low calorie liquid diet and must take supplements to ensure that
he has the essential vitamins and minerals to maintain his health. Under the appropriate conditions, which one of the following compounds can be synthesized in humans, and would not need to be supplemented to the extent that the others are?

5. A person who accidentally ingested a mold toxin that completely inhibited phospho- enolpyruvate carboxykinase could still form substantial amounts of blood glucose from which one of the following?

9. A lack of pantothenic acid would most directly affect the reaction catalyzed by which one of the following enzymes?

The sequence for a portion of a gene responsible for a lysosomal storage disease (Tay2Sachs) has been determined. The normal gene sequence and the mutant gene sequence are given below.

Normal
5' CGTATATCCTATGGCCCTGACCCAG
5' CGTATATCTATCCTATGGCCCTGAC

17. In this instance, Tay2Sachs disease comes about because of which one of the following?

10. A college wrestler has been fasting
for 5 days in order to make weight for an upcoming tournament. Under these condi- tions, glucose is the major fuel for which one of the following tissues? Choose the one best answer.

Questions 19 and 20 refer to the following experiment:
A variant temperature-sensitive cell line was created in which it was observed that when the cells are placed at the nonpermissive temperature they grow for two to three generations, then slowly stop growing and die. An analysis of the DNA of cells grown at the higher temperature indicated a significant level of uracil in the DNA, which was not present in cells grown at the lower (permissive) temperature.

19. What base change is occurring in the DNA at the higher temperature that will eventually lead to mutations, and cell death?

Questions 19 and 20 refer to the following experiment:
A variant temperature-sensitive cell line was created in which it was observed that when the cells are placed at the nonpermissive temperature they grow for two to three generations, then slowly stop growing and die. An analysis of the DNA of cells grown at the higher temperature indicated a significant level of uracil in the DNA, which was not present in cells grown at the lower (permissive) temperature.

20. An enzyme most likely defective at the nonpermissive temperature is which one of the following?
(A) Ligase
(B) DNA polymerase
(C) Reverse transcriptase (D) An endonuclease
(E) A glycosylase

24. An individual accidentally ingests an overdose of supplements containing chloro- genic acid, a chemical that inhibits glucose- 6-phosphatase. After an overnight fast, this individual, compared with a healthy person, would exhibit which one of the following?

30. A scientist was studying the electron transport chain and developed a compound that bound to all the cytochromes in the proteins
of the electron transport chain. Once bound,
the compound blocked electron acceptance by the iron in the heme group of the cytochrome. Which one of the following would be most likely to occur in the presence of an oxidizable substrate?

Questions 32 and 33 are based on the
following case:
A 10-year-old boy displays exercise intolerance, complaining of leg and arm pain after only a short period of exercise. The pain is worse if anaerobic activities are being attempted; for the more aerobic activities, the boy can com- plete the task, but at a much slower rate than others in the class. Hemolytic anemia was not observed in this child at any time. A muscle biopsy displayed elevated levels of glycogen
in the muscle. A stress test in which the boy squeezed a rubber ball over and over again demonstrated a reduced production of lactate as compared to someone who did not display exercise intolerance.

32. The most likely enzyme deficiency in this boy is which one of the following?

Questions 32 and 33 are based on the
following case:
A 10-year-old boy displays exercise intolerance, complaining of leg and arm pain after only a short period of exercise. The pain is worse if anaerobic activities are being attempted; for the more aerobic activities, the boy can com- plete the task, but at a much slower rate than others in the class. Hemolytic anemia was not observed in this child at any time. A muscle biopsy displayed elevated levels of glycogen
in the muscle. A stress test in which the boy squeezed a rubber ball over and over again demonstrated a reduced production of lactate as compared to someone who did not display exercise intolerance.

33. Neither of the boy’s parents is exercise- intolerant. What is the probability that the boy’s parents will have another child with the same phenotype as this child?

41. A woman suffered through intermittent pain in her stomach area, particularly after eating. Imaging tests revealed a large gallstone blocking the upper part of the bile duct. Such a blockage would cause an increase in which one of the following?

57. A college professor, celebrating his 60th birthday, had too much foie gras and wine at his celebratory dinner. The next morning, he awakened with both a hangover and a severe pain in his right great toe, a condition he had experienced a number of times previously. Being somewhat absentminded, the professor then remembered that he had forgotten to take his maintenance medication for this condition for over 2 weeks. His maintenance medication most likely blocks which one of the following reactions?

73. A scientist was studying a fibroblast cell line obtained from a child who had died at
2 years of age because of lysosomal dysfunc- tion. An analysis of the cell line demonstrated that many lysosomal enzymes were secreted from the cell, as opposed to being located in the lysosomes. Addition of lyosomal enzymes from normal cells to the growth medium of the patient’s cells led to the enzymes being incor- porated by the cells and finding their way into the lysosomes. The cellular compartment in which the enzyme defect exists in the patient is which one of the following?

1. The second meiotic division is characterized by which of the following events?

3. A 40-year-old woman becomes pregnant. For approximately how long was the primary oocyte that formed the ovum arrested in prophase of meiosis I?

15. Which of the following structures is the fetal component of the placenta?

43. A human blastocyst is capable of implanta- tion when which of the following degenerates?

30. A pheochromocytoma is a tumor consist- ing of chromaffin cells, which secrete epinephrine; it is generally associated with the adrenal medulla. Embryologically, chromaffin cells are derived from

1. A young man is brought to the emergency department after being mugged. He was stabbed in the shoulder after refusing to give his wallet to his assailant. If the stab wound lacerated the posterior humeral circumflex artery passing through the quadrangular space on the shoulder region, which of the following nerves might be injured?

2. A victim of an automobile accident is unable to abduct her left arm. This indicates damage to which of the following parts of the brachial plexus?

7. A 42-year-old woman presents to an out- patient clinic with a 6-month history of numbness and tingling on the palmar aspect of her lateral three and one-half fingers, loss of pronation, and flattening of the thenar eminence. Injury to which of the following nerves could cause such a condition?

17. During recruitment by the local repre- sentative for the Marines, a young college student presents with the condition known as flat foot. His foot is displaced laterally and everted, and the head of the talus is no longer supported. Which of the following lig- aments probably is stretched?

18. During a sports medicine physical by a local family physician, a young woman is tested for stability of her joints before tryouts for the high school team. Which of the fol- lowing ligaments is important in preventing forward displacement of the femur on the tibia when the weight-bearing knee is flexed?

55. A young man presents to your clinic with a 3-month history of an enlarging mass in his right neck. He undergoes a CT scan that reveals a fluid-filled mass where the com- mon carotid artery bifurcates. Which of the following is another structure that would be located at this level?